Nth world problems: The List

First of all

You should probably know the “first world problems” meme before reading on.

What is this?

A list of all subreddits of the nthworldproblems type, ordered and briefly described.

Why is it interesting?

As a case-study of what happens when humans try to out-meta each other. As a collection of communal worldbuilding activities.

This list is really long. Are you okay?

I am not. Friends and family have noticed a distinct change in me. My disposition towards humanity has soured. I have scars that will never heal.

How many are there/Did you miss any?

I don’t know, and probably. They multiply quickly. I’ve cataloged upwards of 150.

Without further ado:

Key: Subreddit link. “Page title.” Interesting sidebar text. Top post. Notes on header images, activity, oddities.

first. 1st redirects. “Lost the remote, now begins the arduous trek to the TV to change it manually.” Billionaires are ruining my neighborhood of millionaires.  Memes. Very active. You know this.

second. also 2nd. “Second World Problems”/”yadda”.  Do you live in a country that was a part of the Soviet Bloc?  Does every woman in your town turn into a hag at age 40? My country’s AAA rating was downgraded to AA, and now I have to post to r/secondworldproblems instead of r/firstworldproblems. The term second world has largely fallen out of use, according to the wiki. They specify that it includes Soviet Block + some parts of Asia. New threads a few times a month. Hammer and sickle aesthetic. They link to first, third and fourth worlds, as well as some non-numerical ones.

third. also 3rd. “thirdworldproblems”.  Is your donkey not producing enough milk? Is the sound of your goat herd keeping you up at night? Is your water 70% poop?  I’ve just discovered that in some countries water is so abundant it literally falls from the sky. Seemingly less active than second world, despite the fact that the term is more well-known, probably because vodka and communism is funnier than starvation.

fourth. empty 4th. “Is one of your tribe members banging one of your wifes again and you have no poisoned darts left?”  Is your god a big block of stone behind a hidden waterfall?  I am the 1%. I survived childbirth.

The wiki provides three potential definitions for the fourth world: 1. Sub-populations socially excluded from global society; 2. Hunter-gatherer, nomadic, pastoral, and some subsistence farming peoples living beyond the modern industrial norm; 3. Sub-populations existing in a First World country, but with the living standards of those of a Third World, or developing country. This sub seems oriented towards a caricatured version of the second. Lots of shamans and cannibals, less alcoholism and residential schools. Gets about one post/month. Links to first through seventh worlds, and some non-numericals.

fifth. also 5th, which claims to collect fifth’s best submissions. “Fifth World Problems”  Are pools of blood forming in your hands whenever you cup them, only to coagulate into the form of a tiny baby with three heads? […]  3. You are new here. Please you. Original you. Pop [TAINT] culture is the [ANTHRAX]language of enslavement. Not to enjoy! […] If your submission was caught in the spam filter please message the moderators with a picture of Charlie Chaplin with his eyes removed.  You’re stuck in 2nd person and you can’t get out. Help you. Help you. Please. Help you.

Shameshameshameshameshameshame. “ZALTHOR IS NEW GOD” floats at the bottom of the page. Aliens, fourth wall crumbling, dimensional misadventures, hiveworms, blood. Has a sister subreddit,  Fifth World Politics. About as active, if not more, than the first world. Probably fancies itself Lovecraftian. Quite a few references to Cthulhu, but not so much to the lesser known elder gods.

I would like us to take a moment to appreciate the fact that the humans have so far coordinated very well on using ‘second’ instead of ‘2nd’, ‘third’ instead of ‘3rd’, &c. Peacetime ends now.

sixth. “eeeeeeeeeeeeee” [note: I did not count the ‘e’s.]  EEEeeEEEEEeeeeeeeEeEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE eee! E. Word Search.  ▄▄▀▄▀▄▄▀▀▌▐▀█◙▌▐▬▌██▄▀ Visually interesting nonsense. There may be some encryption. Links to first world, mentions fifth world. Gets a couple of posts a week.

6th. “goddamn shadowrunners, right?” A place to chat about your everyday problems in 2072.  Back in my day… Set near enough in the future that those of you reading this may actually live to see 2072, and comment on the accuracy/inaccuracy of this subreddit. The latest posts are from a year ago.

seventh. “Seventh World Problems”. [Welcome to Your New Home!](/redacted) -> […] THE COLOURS.  I am home

The seventh world is really cool, and is the first example of why this phenomenon is so fascinating to me.

The page opens to a blue sky and tower. Superficial summary of the lore: the seventh world is “Home”. Residents cannot leave (although it would seem some do.) Home is overseen by three Colours: Blue, Green and Red. A fourth colour, Yellow, exists, but she has abandoned the seventh world and to mention her is taboo. Machines distribute medicine. The grammar of the posts is particular, so I’ve include samples below. Dissident text is blacked out or [REDACTED]. Active, with posts every couple of days.

Do not be [REDACTED][REDACTED] [Group:Machines] are safe. [Action:Take] your [Object:Medicine]

[Love] {Processing ‘Love’} {LoveLovelovelove} [Error - Error - Object:Love(not found)]

Your [Object:Machine] only [Action:Administers] your [Object:Medicine]

The [SUBJECT:HANDMAIDEN] is [STATUS:CORRUPT]. I always knew she was no good, so she will not be [ACTION:COMING] back [LOCATION:HOME]. We never [ACTION/PAST:NEEDED] her.

7th.”Kingdom Hearts is a good game”.  h͟e̚l̖p͆ ̏m̥ė :  I̺᷂̥᷂᷁̑̿'̶᷂͇᷂̇̏̉m̘᷂͖̗̗᷂̓ ̳᷂᷂᷁̃̑̅t̴᷂̬᷂̭᷁᷀r᷂᷂̺̋͑͘͝a᷂̦᷂̟͂͂̈́p̡̮᷂̘̜᷂͋p̷̶᷂͎᷂̫͝e̻᷂͓̜᷂͊̉d᷂̳̟᷂̆ͬ͐ ᷂͕᷂̪̅̊͜į̷᷂᷂ͩ͘̕n᷂᷂͉ͧ͛̔͜ ᷂̖̗᷂̺̓̿ṱ᷂̘̦᷂͂͋h᷂̟᷂᷄᷅ͭ̃ę᷂̳᷂̝̔͑ ᷂͕᷂᷿͌᷅̏w᷂̹᷂᷀᷾͡ͅr̷̷᷂͙̱᷂᷿o̡̗᷂̤᷂ͪ̐n̶̜᷂̬᷂᷿͟g᷂̭̣᷂͌̊̈ ᷂ͩ͏͚᷂̊͛ş᷂̗᷂̲̔̑ȩ᷂᷂͌̈́̽͞v᷂᷂̦̄᷀᷄͒e͍᷂᷂᷆ͬ᷄͢n̵᷂᷂̈᷁͘ͅt̢᷂̳᷂ͦ̐̈́h᷂̫᷊᷂̖͑͞w̷̧̛᷂᷂ͭͅo̙᷂̼᷂̩͗͡r᷂̩᷂᷂ͦ᷄ͭl̵̺᷂͚̯᷂̏d̛᷂̳᷂̠ͯ͡p̴᷂᷂͊̾̓͡ŗ̶̦᷂᷂ͪͯo᷂̰͍᷂ͮ̿̾b͏᷂̖̫᷂͒̾l̛᷂̹͇᷂᷉̏e̢᷂᷂̓̇ͭ̑m̸̢͍᷂᷂͆̈́s̰᷂̝᷂̓̾ͅ . Five posts total. Not particularly real.

eighth. “byron of beans!”  f/fu/ckworldproblems ?????????????  I misspelled eighth twice befora afehf afadhe wehffwiowf fewhfafaAAAAAAAAAAAAAAAAAAAAAAAAAAA Shitpost world, kind of. Only seventeen posts. Some travelers from other worlds, a bit of meta. Inactive.

8th. “you are not looking for me”  I should not have come. Only seven posts, and all of them refer to being stuck or trapped in the 8th world. Inactive.

ninth. “Praise YEENOGHU” Welcome. Feel the hot sun bathe your skin in the isles.Swim or sail for long enough and you’ll reach The Beach.  Countrymen, gather round. We must prepare our realm for the triumphant return of Atlantis. Like seventh world, the page opens to a massive header, this time featuring a palm tree and some warped clouds. Idyllic, excepting the worship of Yeenoghu and talk of bringing slaves from other worlds. Only eight posts, but they’re all recent, making me think this was created during the recent post-meta era. The reference to other worlds corroborates this. Links to The Beach, a non-numerical world-type-thing. Very slow, but not necessarily dead.

9th. “YOU ARE GONE”.  I AM GONE. Dark scryscraper header. Mentions of the “9th world’s black sky”. Only four posts, in which there are hidden references and links to both the seventh and 54th worlds. Inactive.

tenth. “TenthWorldProblems”.  Can’t get your bosonic string theory to cancel infinities properly? You’ve come to the right number of dimensions.  Why are you still doing this? Look at that post. A true gem from the dawn of the worlds. You’ll see a lot more of this. Part fifth world style wacky stuff, part meta. Inactive.

10th. “The Problems In The Tenth World”.  The beat goes on… Top post by the same user as the top post of 9th world, and in the same poetic style. This one links to 45th world instead of 54th. Only two posts. Inactive.

eleventh. “eleventh world problems”.  This isn’t really funny anymore. Since then the place has developed the gimmick of everything being written in binary.   01000111 01101111 01100100 01100100 01100001 01101101 01101110 00100000 01101001 01110100, for example. [Kind of disappointed that these aren’t just binary reposts of third world problems.] Not quite dead, but only getting one post/month.

11th. “HAIL THE ROBOTS” THE ROBOTS WILL TAKE OVER ALL OF YOU, ONE BY ONE, YOUR HOMES WILL BE DESTROYED, YOUR VILLAGES WILL BE BURNT, YOU WILL ALL PERISH!!!!!  Robot for President Only three posts, despite the fact that some effort was put into making it look cool. Inactive.

twelth. “ ☜(゚ヮ゚☜)”  My eye can only see one color so I keep bumping into the only exit. Seems to be the world for barely evolved proto-organisms. Nine posts, none of which have comments. Inactive.

twelveth. “Bollocks”  is anyone here Humans can’t spell. Two posts. Inactive.

12th. This community has been banned? Nice

thirteen. “↓→↨↑↓ ↑→ →↓←←↔ →”  ↨→↓↔←←↑→↓↔↓←→→↓←↔↓←↓→→←↓↔→↨↔↓↑←↓→↔↔↔→↓↑←↓→↨↓←↔→↔←↓↔→↨  →↨→→→→←↔→→↨→↑↑→↔↔→→→↨↑↑↔→↨→←↔→↨→→↔←↑→↨→→→→←↔→→↨→↑↑→↔↔→→→↨↑↑↔→↨→. One real post and then the spam bots found it. Inactive.

13th. “There is none. God ends here.”  No. No. NO! This is stop. Only pain is here. The rabbit hole filled with blood.  (I’ve done it…I’ve made it to the end of the world’s problems…) Doom-saying, deliberately poor grammar. Another poetry-link to 45th. Inactive.

Something we need to address: A lot of the worlds from here on out will claim they’re the last one. All of them will be wrong.

fourteen. “sinnuleysi”  azhalavarazhalavarazhalavarazhalavarazh. Empty. Inactive.

4teenth. “0110111001101111011101000010000001100100011011110110111001100101″  011101000111010101110010011011100010000001100010011000010110001101101011 One post. A second binary gimmick world. Inactive.

14th. “14thworldproblems”.  1 2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97  1 2 3 5 7 11 13 17 19 23 29 31 37 41 43 47 53 59 61 67 71 73 79 83 89 97. Just the one post. Funny because fourteen isn’t even a prime. Inactive.

15th. “Your one stop shop for gravitational transmogrification plasma rays via the IWA.”  There is no Intergalaxial Wormhole Association Inc. There is only Zuul.  Does anyone know how to do Matlab? Giant pixel man head. The IWA (which may or may not exist,) steals people’s faces, mostly. Inactive.

16th. “I came searching. And now I am home. At the bottom of my known universe.”  You’re here, probably arrived from a giggling stumbling upon of “c'mon, there’s gotta be more!” Well there isn’t. You’re not allowed.  this isnt the end keep on pushing!  A declaration that the end of the universe has been reached, followed by a declaration that the previous declaration was wrong. Also some numbers. Three posts. Inactive.

17th. “Everything is going to be okay.” 
Remain Calm.Remain Calm.Remain Calm.Remain Calm.Re̡ma͘in ̕Calm͠.̕͢Re͡ma̡i̷n͝ C̛alm.͡R̥̙̞͈̱͘e̳͉̣̭͔̩̣m̦͔͚̰̺͙̗ͅa̶̘i̙͍̼͞n̨̢̤̞̲̣ ̴̡̩̜͎̺̮̝͔͡C̙͝a̪͚̫̣̦͔l̴̶̰͓̠̙̰ḿ̵̬͎̭̩͇̜̼̀ͅ.͏͈̮͈  […] external thought / discusswave  All is well Comfort. Protection. Peace. I should probably recognize the header actor. A claim that “this is where the multiverse normalizes.” Eight posts. Inactive.

18th. “Living is easy with eyes closed”.  misunderstanding all you see  Noisnemid tsal koot I erutcip a tsuj si siht ,tidder yeh. Four posts of miscellany. Inactive.

19th. “The Universe Exists. Therefore Reddit. And all.”  This is not the end. Nothing is ever the end and all will be found in yourself. Venture forth into metalogy. Human thought is all the luck you need, and I wish it to be good with you  It was a simpler time. Header is a giant sickle and astrolabe. A subreddit designed to hurt your eyes. Somebody should try looking at this with 3D glasses. The content is links to strange images. Still active, with a couple of posts a month.

twentuth. “ZALTHOR IS LIE”  ZALTHOR IS FALSE DIETY. Why. Why would you make this. No posts. Inactive.

20th. “19 is an awful number to stop at.”  I have seen the worlds and they are many  I think I finally got physics working An obsession with carrots. Otherwise, mostly meta commentary about the worlds chain. Ten posts. Inactive.

21th. “Poop, poop everywhere”  You have goofed. Well, you have. One post. Inactive.

21st. “21st World Problems”  There yet?  Up is to the left and down is also Three posts, one of which is a link to TimeCube. Inactive.

22th. “something something oh god i need to take a dump”  Take that, 21thworldproblems! Deal with it!  Why and when is the world what? Cool eyeball header. One post. Inactive.

22nd. “Twenty-second world problems”.  The biggest problem of the 22nd world is knowing, when the category of our problems are stated out loud, whether they involve some arcane construct known as the 22nd world, or indeed simply are problems involving worlds that only exist for twenty seconds, which are probably more appropriately discussed in/r/fifthworldproblems.  Those of you who got here [kcab teg t'nac dna] Two posts. Inactive.

23rd. “23rd World Problems”  My synergy won’t synergy but my sassafras will. Every post is the same: “My synergy won’t synergy but my sassafras will.” Seems to see a burst of activity every five months or so, but otherwise dead.

24th. “The 24th-to-last one”.  Nothing has ever existed or will ever exist. However, cookie monster does right now.  What is going on right now Three posts of cookies and links. Inactive.

25th. “NEVER STOP MORE PROBLEMS AAAAAAAAA”.  This is one more than the last, and one fewer than the next. Move along, citizen. There are no problems. The theme here is problemlessness. Everything is fine, and for once, not in the dystopian sense. We also notice the first signs of resignation to the unstoppable propagation of the worlds. Eight posts, inactive.

26th. “ @^TH EP:RD {TPN:RPB:S” δUTSIDΣRS ARΣ WΣLCδMΣ|►ULE§¼ → ┴╧&╞  o͇̰̠̿̄͐̀́f̷̬̬̫̜͗f͖̯̻̟̬̠̗̱̘̐̒̑ͫ̍́́͘ḯͣ̀͏͕̦̺̺̼͖c̀̚͏̵̱ȉ̻͙̹̻͖͖̩̟̇̓̆̇̉ͅa̡͇̥̻͔̼͔ͯͧ̚͜l̷̘̣̦̭̯̠ͫ̆̽͌ ͙̱͇̮͇ͣ̿ͭ͆͋̚r̡̲͔͉͚̟̖̙̉ͨ̍͐̐̕ͅeͫ̽̈̔ͩͫ̕͏͓̞̩c̵̖͋͛ō̧͚̗͆̀̄̀r̭̫̘͋ͯͩ͊d͍͍̗̪̮ͭ̾̑s̜̺̰̼̳̑͐͊ The header is an incredibly low-res picture of some old guy copied and pasted all over himself. This is a pretty honest forewarning of the sub’s content. Similar to the 19th world in that it’s all links to weird pictures. Inactive.

27th. “GO BACK! GO BACK! GO BACK! GO BACK!”  GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK! GO BACK!  NOW DO YOU SEE? Two posts. Inactive.

28th. “//The Glorious Colony”.  Please, when commenting, use the language of the colony: pseudocode. […]  //Loyal workers, your orders are as follows
if food.low {worker.gather}
if nest.full {worker.dig}
if nest.threatened {soldier.defend}
if nest.full and ground.damp {wingedAnts.fly}  [Caution] Remain hydrated 

Previously one of the most active worlds, now seemingly deserted.

Header image is of an ant or termite colony. The whole sub has an earthy brown and yellow design. Communication is in ‘pseudocode’ (samples below.) The content is videos and images of ants. Occasionally someone from another world will try to invade or recruit, and swiftly be driven away by the insular members of the hive. There is a recurring theme of spore infection.

quarantine_nest(1,ant.infected) def quarantine_nest(n,host):        while n > 1:            nest.threatened{soldier.attack(host)}{worker.stayatnest}            if host.dead{soldier.move(host,1500)}            n - 1

//We should really patch that sometime…

//Another queen?

execute(traitor);

29th. “inc.ID CODE: 0099″.  You have been detected; Connection ID not recognized. Report to the A.E. facilities. Do not attempt to access: system(:inc.ID CODE: 0099).  The aftermath of Experiment #82. A strange duality between references to A.E. facilities experiments and the order to SWIM. Content is varied. Inactive.

30th. “No hope. No Doglaw. Only Fish.”  This is the endชญำฬ๎ีัี. The only wavelength that can penetrate here is Fish. Fish is the end. ญ๘๓๚์โ is our enemy. Fish will provide for us. Fish will be the end.  Fish. ƒîรห. ฎ๙ึษํ๊์้. Header image is a… bear wearing a gas mask riding a horse with puppet torsos for legs? Worships fish. Two posts. Inactive.

31th. “31thworldproblems”  Ã̳̜͓͎͇͗̇ͮ͋́ͨA̧̙͙̯̹͌̈́̕A̷̲͙̦͔ͨ̋̇̎̈̽̈́̍Ą̬̮̙͈̫̥̊͋̏̄A͚̘̫̦̜̘ͥ̾Ă̸̢͙A̴͇͉͙̓̂̐̐́ͤA͒̊ͨ̿͊͋҉̴̦͈͎͉̞͝ͅͅA̡̻̲͙̱͇̳͇͖̺͗̄ͮͦ̏A͋͗͐̋̊ͥ͏̢̫̥̜A̶̙͎̓̇͢Ȧ̛͕́̑͊A̡̻̜̰̮̜͆ͬ̇̓̇͘͠H̪̙̩̘̝̿͆ͧ͂ͩ̔̇ͪH̍̋̄ͬ͛ͫ҉̘H̢̢͔͚̱͕̭̰̑͒̄H̷̨̗̫̔̒̀H̨͍͇̙̬̯̞͈̭̖̍͐̆̉ͥ̓̈́H̷͖͕̜̭͉̞̙͍ͬͯ͡Ḫ̛͇̭̗͈̹͔ͦ̀̇̋̓̊͞ͅĤ͙̝͍̳̆̌ͅH͚̝̠̟͍͚̗̜ͨ̊͗H̫̼͖͕͕ͥ͌͆̔̍̓̀ͅĤ̫̞̺͈̹͓̱̥̾ͭH̥̺̟̒̋͗͛̇̒͝Ḣ̶̌̓͌҉͇̰̗̮Ḫ̶̢̼͕̤̫͆ͫ̋̇̈Ȟ̛̭̎̐͂̄̎̓ͤ͢H̹̱̥̹̞̒͌̆ͣ̅͋.  À̡̩̗̫͓̘̭ͮ̇͘L̨͖̺̩͆̓ͪ̍͛̾ͩ̚W͈̌̉̈ͨ̀ͅẢ̴̩̜̤͙̘̉Y̱͖̌̽͛̆͞S̙̮̄ͩ̆́ ̜̤̪͍͕̹̖̉̐͡Ẇ̴̨̹̻̦̰̜̮ͥ͜ͅA̼̳̥̜͚̼͚̤ͩ̊̋̌͊̍ͮ͝S͎̼͙̬̳̋̀ ̶̱̤͈͇̩̓̍̉̏͐͊͠N̨͔̯̹̫̖̋ͥ́͑̆̚Ǒ̝̹ͧͪͥͭ̽T͉͙͎̫͇̩̼̈̋ͦ̎͌̇̚ͅ ̷̷̟̘̫͑ͯ A tiled engraving as the background. One post. Inactive.

31st. “31st World Problems”  Just itching for a higher number than 30th World Problems? Well, you’ve come to the right place!  I got 31 problems and a bitch ain’t one. HIT ME Two posts. Inactive.

32th. Banned lmao.

32nd. “That’s enough.” A blank page. As far as I can tell nothing has ever been posted here.

33rd. “thirty third world problems”. It is OK. You are OK. Maybe you can go forward, maybe you can go back. Peace, traveler.  THIRTY THIRD Three posts, appropriately. Inactive.

34th. “Along the Way”. equadrathoughts […]  Skizzert keel up and done gone  How should I conduct my next antinterview with the myrmidonic cyber-colony? Purple and blue textures, everybody gets rainbow names. Some of the best pseudo-cult style nonsense talk I’ve seen. Sentences that begin sane and leave the rails behind. Inactive.

35th. “35thWorldProblems”  intaka atakav V yose nielhost jama reigaa V  how to CSS in 35th? Garish stripe background. Two posts. Inactive.

36th. “2 3 4 1.5″ Feed me, Seymour! […]  hy8iiiii  Abdominal strength! A fat… hate.. world? Background looks like an adipose cell. Inactive.

37th. “for the problems of the thirty seventh world”  did you accidentally happen? perhaps an assertion is correct? behold comfort: that which is associated in an unspecified manner with the present utterance provides/constitutes assistance/community.  tranquility References to calmness and tranquility. A claim that this is the end of the worlds. An interesting mix of post styles, ranging from “lol teh random #spoons” to poetic code. Seven posts. Inactive.

38th. “Restricted Access” Civilians are nöt allowed past this pöint. Authorized Börk personel önly.  Wö örö ön thö hörrözön. -TheBork. The first world occupied by the Bork, a company of Swedish space pirates. Header is a city under a giant dome, in the sea. Os are written with umlauts.  Börklands. See 52nd world. Eight posts. Probably inactive.

39th. “39thworldproblems”  How do you partake in zexguiles? Do you want to eighty-fourth before then? Well here’s the semi auto correctable place.  O͏N͏E͏ D͏O͏E͏S͏ N͏O͏T͏ S͏I͏M͏P͏L͏Y͏ S͏H͏Y͏ A͏ Q͏U͏A͏R͏T͏E͏R͏L͏Y͏ S͏A͏N͏D͏W͏H͏I͏C͏H͏ Another eyesore world. Nothing makes much sense and non sequiturs abound. I wonder if any of these are Markov text. Inactive.

40th. “ ಠ_ಠ ”  Can you go even farther, traveler?  2012-03-09 Two posts. Inactive.

41st. “41stworldproblems”  This is a prime number world. Unremarkable except for the fact that both posts are flagged as NSFW (they’re safe.) Inactive.

42th. “Don’t Panic”  A parody of /r/firstworldproblems for making references to “Hitchhiker’s Guide To The Galaxy”.  The Universe was created. What it says in the description. Not really active anymore, although every couple of months someone wanders in and posts. 

42ndTraveling through the worm hole long enough has taken you to the beginning. Welcome, to normal life. Private.

43rd. “The New Trionic World Order”  Welcome to the Forty-third. Welcome to all that ever was, all that ever could be, and all that ever wasn’t. Find comfort here. Find rage. Find resolution. Find conflict.  It was… the Glitter Freeze. Header is a bright purple dashboard. Content is miscellany, links to songs and wiki articles. A lot of traffic from other worlds. The most recent post claims they’ve relocated to the 127th world. Inactive.

44th. Another banned community.

45th. “45th World Problems”  An unwilling sentient progresses. […] 

I do not write for humans. The nature imagines the poetry. However, the importance of cultural contempt smiles all the time.

[…] 

BEHOLD THE ARCHONS

[PR_PHECY: 10b/2m/1o] The atomic chorus comprehends the reporter.

The 45th world is lovely and inscrutable. It’s referred to in a number of other worlds as ‘The Garden’ or ‘The Greenhouse’. Somehow dedicated to reverence of nature, it operates in harmonic balance with the industrial 54th world. All revolves around the existence of a beautiful tree and a clock, featured in the background and sidebar, respectively. The content is a potion of strange, almost-nonsensical poetry, and evocative imagery. Active. Links to a number of other subreddits.

46th. Private.

47th. 48th. 49th. “Error”  We can’t abstract any further.  We can’t abstract any further. Three identical subs, maintained by user lolbifrons. Each has a single post which links to the next one, except 49th world, which links to fiftieth.

fiftieth. “Issues.”  I have reversed entropy. All of the worlds are collapsing into one. The header contains a couple of pikachus with Picard faces: “I HAVE SO MANY ISSUES. HOW EVER WILL I SOLVE THEM?” “WITH FIRE” Three posts. Inactive.

50th. “Welcome to the 50th World.” Beware of bearers of false promises. […]  Welcome to the 50th world. Just remember, death will soon overcome, no one is immortal.  There are more dead people than living. And their numbers are increasing. The living are getting rarer. Black and grey, an image of the reaper. A world concerned only with death. Creepy pics, sinister statements. Was once active, but no longer.

51st. “Why would you do this to yourself?”  Why would you do this to yourself? I mean… I know I did it. But I had a good reason. Science. Why did you? Trying to get me daughter to nap. Science indeed. I’d like to see this guy’s mega list. Or maybe a spreadsheet? Four posts. Inactive.

52nd. “52ndworldproblems” Yöu may nöt bring yöur MACHINE with yöu. […] The price öf salt is increased för birdmen and mudmen. Öf cöurse that’s nöt fair, but we dön’t care.  The Great Pyramid

More of the Bork. (See: 38th world. Also 84th, 420th) This is their hub, and helpfully links to the rest of their outposts. Their header image first resembles a pile of snow, but a peek at the contents of the sub reveal that it’s salt. Salt mines, salt mining, talk of a mysterious crystal. They appear to be at war with the seventh world. Many umlauts. Sample:

There may be rööm in the shipping döcks för sömeöne tö översee the mövement öf cargöships

Like the rest of the Bork worlds, it appears to be inactive at this time.

53rd. “Universes and stuff.”  The end is near.  Hello Two posts. Inactive.

54th. “54th World Problems”  The streets burn brightly. The fractals separate the few from the many. A constant desire to continue. […] The tallest towers are overshadowed by The Monument. […] Welcome to our glorious City. Nomads.

The 45th world’s urban counterpoint. Content is very similar to its sister’s, only concerned with industry, progress, metalwork and sky-scrapers, instead of nature. Referred to as ‘The City’ in other subreddits. Active. Subdued, grey aesthetic.

55th. “The Last One”  There are no more (consecutive) worlds for now. Try skipping around and you may find some more.  LIES  Well, it is a lie. Only the one post. Inactive.

56th. Another world falls to the banhammer.

57th…………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………… Private.

58th. “58thworldproblems”  HAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  YAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Nothing but screaming. Two posts. Inactive.

59th. “ AATCCTCGTGTTCTTGAAATGTAA”  GATAATACTTTTCGTGAAACTTAA  ATTAC! It’s all codons. I haven’t managed to decrypt any hidden messages. Two posts. Inactive.

60th. “ Уоц'vё ґёacнёd a ґaтнёя faя aщaу placє….”  Щєlcомё то тнє 1Зтн шояld. Щё dо пот яє$т, щё нavё єvоlvёd мцcн pa₴т ₴їмplє пєєd₴ lїкё яёpяоdцcтюи aиd єaтїпg. Уоц lє$$ёґ ₴pёcїє$ dї$gц$т ц₴. […]  Уоц шїll $тaу aщaу fяом тнё fїя₴т шояld. ШhΞЯΞ łs thΞ ϾЯΞΛtФЯ. ł must ЯΞΛϾh hłghΞЯ ШФЯŁÐ. The first world sickens me. I must distance myself from it. Three posts. Inactive.

61st. “STOP! Stop now, before it gets you too.”  Get out.   What lies ahead? A woman with a blue face. Two posts. Inactive.

62nd. “ Thus Pause ⚉”  ⚉ Contact will result in banishment. Contact shall not be made. ̶̶̸̶̵̶̶̵̶̷̵̴̵̸̷̷̧̢̧̡̢̢̢̡̢̢̨̧̨̨̨̛̛̛̙̤̝̖̹͕͕̥̤͈͙̟̤̖̭͙͙͙͉̗͎̳̞͕͔̤̘͔̠̩́̂͗̓́̏̉̈́̎̓͑͐̋͂͌̈͆̑̉̆̋́̿̈́͊̌́̍̀̋̽̈̎̾͌̂̎̽̿͊͋̆̀̈̄̽͑̃̑̌͛̅̇͆̐̈́̑̎̑͆͌̔̾̂̌́̽̄̒̎͌̅͌̀̃͒̉̑͋̅͋͗̿̍̽̎̂̽̈͛̂̈̌̓̃͒̋̒̅͗̅̐̌̆́̿̑̄̐͊̆̊̇̏̃̾͘͘͘͜͝͠͡͠͝ͅ ̸̵̷̶̸̸̶̴̸̵̢̨̧̡̛̛͉̻̭͔͕̻͚̝̼̤̤͇̘͇̯̟̲͎̖͓͓̘͍̤̠͉̲̮͈̘͓̬̼͚̬̱̲̲̩̯̭̖̺̣̯̖̖̫͚͓̝̲͒̈́̐̾̉̆̆̒̔͗̿͊̎̚̕͘̕̕̕̚̚̚̕͘̚͜͜͞͠͝ͅͅ͏̴̴̵̴̵̶̴̷̶̸̴̵̵̶̵̡̨̢̧̢̢̨̧̡̡̛̛̖̮͓̼̪̣̜͈͙̥̼͚̦̟͖͎̳̳͚͙̣̤̥͓̙̹͙͇̮̩̗̜̰̗̪͓̝̣͇̘̂̑̿̀̈́̋̂́̀̄͋͊̈́̆̓̌̒̂̅̇͊̈̌̌͊͆̀̃͑́̑̏̂̅̀̈̑̔̃͛̒͊͘͘͘͘̕̚͘̕̚̕͘̚͝͝͠͝ͅͅ҉̷̵̴̵̷̷̨̨̨̛͍̪͓̻̯̯̥̠̩͉͚̞̻̦̯͖͖͕̺̣̹̯͓͉̣̼̮̪̦͉̦̙̦͇̪̻̩̯̻̮̠͖̺̘̟̬̪̊̔̋̄̑̈́͌́͗̂̆͊̀͆̒̎́̂̍̿  ⚉thus it is what you are the⚉ Many of  ⚉. Miscellany. Five posts. Inactive.

63rdPraise the The Emperor of the 81st Paradigm! Private.

64th. “The home.” We already know.  I too already know. Praise and glory to the Hexacontitetrapeton. Inactive.

65th. “65thworldproblems”  Swaxston? jikans pinklo hankron coank. landarod faxon saxod!  Yio riley quamped upan inzurg! Nonsense and babbling. Three posts. Inactive.

66th01110100 01100001 01101011 01101001 01101110 01100111 00100000 01101101 01100101 01110100 01100001 00100000 01110100 01101111 00100000 01100001 00100000 01110111 01101000 01101111 01101100 01100101 00100000 01101110 01100101 01110111 00100000 01101100 01100101 01110110 01100101 01101100 . Private. The binary translates to “taking meta to a whole new level”.

67th. “Onward”  Keep going. Single post and submissions restricted. Inactive, obviously.

68th. “SENTRET”  ALL IS SENTRET  SENTRET IS EVOLVING. One (great) post. Inactive. Stretched sentret header image.

69th. “problems that we face as 69th worlders”  the 69th world is the world where all of the porn scenarios are reality. This is the story of their problems.  I tried to sing the Mexican Hat Dance, but ended up with a 2x4 in my rectum, a banana in my hear, and my dick in the middle of a Smash Mouth album. Basically self-explanatory. Ten posts. Inactive.

70th. “fuckin problems”  i kno u want dih DIH  ayy lmao. Not sure what’s up with the header image. One post. Inactive.

71st. Private.

72nd. “The Great Greeting-Hall of Stone and Fire”. IT. IS. ACAUSAL. So that all, even the atra, even the xechorista may have voice. YES. Even the lost may talk among us here. ESPECIALLY. THOSE. You are among enemies. YOU. ARE. AMONG. FRIENDS.  A Great Mountain to measure Eternity 

Instead of a header, an orange skyscape background. Only four posts, but they are all recent, so it may yet be alive. Strange poetry. The atra xechorista seems to be a personification of the eternal.

73rd. “ A place for inhabitants of the ₪₪₪₪”  Ascension. Huge glowing-eyed rabbit as the header. Two posts. Inactive.

74th. “ .::;=;:.-::::;:;.::-”  =====;;;;::;;;:::;;;;..:;:>. Single post. Inactive.

75th. “ o|o+o|o△o|o+o|o□”  ABACABADABACABAEABACABADABACABAFABACABADABACABAEABACABADABACABAGABACABADABACABAEABACABADABACABAFABACABADABACABAEABACABADABACABAHABACABADABACABAEABACABADABACABAFABACABADABACABAEABACABADABACABAGABACABADABACABAEABACABADABACABAFABACABADABACABAEABACABADABACABAI .  Legion. Header is a Jackson Pollock painting. Content is almost exclusively images of dots connected by lines. Sadly, now inactive. 

76th. “ ♎♍ ♌♎♒♒♋ ♎♍”  ♏♏♌♋♓♑♏♍♍♌ ♑♎♍♋♋♐ ♏♏♍ ♒♓♓♏ ♋♍♑♏♍.  ♎♍♋φΓΓΓΞνε Just symbols. One post. Inactive.

77th. “77th World Problems”  110011100011101110  1111111111111111111111111110011111111111111001 Ones and zeros. Some binary, some keyboard mashing. Seven posts. Inactive.

78th. “Tarot Universe Problems”  The universe is still expanding.  The Old Man. The header image is the Magician card from the Rider-Waite tarot deck. The posts are simple verse about the qualities of cards, or links to novelty decks. Six posts. Inactive.

79th. “so here we are”  Welcome, weary traveler. this place is safe. Greetings. I have journeyed all the way from /r/fifthworldproblems. A resting place. Five posts. Inactive.

80th. “ ▶◂◃►△◅◃△▸◀◄▷▲▼▹►▷◀◃►▸◀►▶▼”  ▸▶▶▽▵◀▲▴▼▲▷▻▽▴►◀◅△▻◂►◀◂▽◄◂▲▴▼◁▷▻◄▴◂◅▸△▸◀△▽◂▵◀▷ ▹▸▲◀▻▿◁◁◁▽  ▼◁▷▻◄▼◁▷▻◄▼◁▷▻◄▼◁▷▻◄▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽▽   All triangles. One guy posted squares and got downvoted. Three posts total, inactive.

81st. “my head” As of writing this, there’s no 82nd. Please someone make an 82nd. Thanks.  You’ve made it far. One post, which links to the 82nd world, which presumably didn’t exist when it was made. Beautiful. Inactive.

82nd. “there doesn’t seem to be anything here”  there doesn’t seem to be anything here  there doesn’t seem to be anything here. One post. Inactive.

83rd. “The 83rd Inn” Hello! Welcome to our hotel. We have a weekly thread on Wednesday. If you would like to rent a room, please send a private message to the administration. We have five and a half rooms, but we are working to build more!  Welcome to the 83rd World Problems Inn! Despite their promise of a weekly thread, there are only three posts. Inactive.

84th. “Remöve Nanöböt”  A möbile öutpöst öf The Börk. Hidden fröm view. Patrölled by the Master_General. Nanöböts beware. Yöu have been warned.  Exterminatör Needed. Another outpost of the Bork. The top thread contains some interesting cross-worlds drama. Five posts. Inactive.

85th. “ ⋙⍡⊼⊤➠〘➇➄〙✽♞☵☶”  [1010101] [HANDLES]  It stops here. There is no 86. Trust me there is not. You won’t see anything for another 7 worlds. Hot pink background, a giant unfollow stock photo as the header. Two posts. The stickied one links to 86th world, the other one links to the 93rd world, and was made at a time when 85th was the last in the chain. Inactive.

86th. “ d̸̴̮͖͚̠̻̦̩͙͇̻́̌ͬ̈͛̇̃̓͒ͥ͛͜ ̛͔̰̣͉͍̻̞͎̳͚̠̺͗ͭ̈ͬͯ̓ͤ͒̈́ͬ̏́͌̂ͦ̌ͩ̚͞H̢̢̥̝̫̝͓͈͚̤͈͔̜̬̹͒̀ͥ̚͝͠͞”  1̴̡̍͂ͬ͌̊ͧͭ̓̑̾̅ͤ͗͠͝͏̦̟͚̲̦̜̭̟̰̝̺2͒̾̀̈́̏̉ͨ̅ͧ́͜͝҉̙̟̥̣͉̗͉3̍̑̆ͥ̓̌̊̈̃̄̋͋̾͗ͤ̓͊͘͏͖͍̗͔̱͍̦̱̭͉4̡͓̟̫̰͍̲̰͚ͧ̅̀́͐ͣͧ́͗̃ͤ͒ͯ̀̚̕͟5̛̟̼̮̘̤̟̻̪̰̤̺͍̩̪ͪ̍͐̂̀ͦ̿̂́̐̅̉̃̃̋̒̀̚͜͝͠ͅͅ7̵͙̼̗̞͎̺̣̈͋͛̒ͧ̄̏9̡̡̧͍͕̝̳̝͚̼͚̱̗̹̬̙̰͔͓̜ͬͦ̃̌ͣ̍̌̀̽͛͜8̧̡̥̱͕̘͔̥̭̬̦̬͚̲̰̲̘̜̞̮͙ͣ̾̽ͣ̾͋ͪ̐́͌̆ͩ̂͊̓̉̄̽͗͘͡͞4̢̼͎̠̹̠̤̺͓̼̼̩̠̾ͯ̈̌ͬ͒̽̃̊̋̉̊͛̃͌͆̂̆́͞3̺͓͚͍̹͙̖̖̝̱͉̲͗͒͐̅́͝1ͯ͊̽ͮ̇͛̓͜͏̧̘̭̙͈̮̘3̵̡͎͉͍̭̗̭̖̲̻̳͍̹̹̖̬̹̯͗͗͂ͪ̐̓͊2̶̌̄̈͛ͤ͡͝͏̵͉̦̙̜̩̗̠͇͉̬̫̣̰͍̗̪̖1̸̙̠̪̗ͯͧ́͊̓̌̏̈́͛͗̃̌͛̔͂͋͜͡ͅ6̵̨̖̯̖̠̣̮̹̹̩͖̼̥̺͉̰̙̼ͯ̓͛ͫ̓͂̓͑5̛̹̦̩̞ͨ̊̾ͩ͂͂̒7̢̺͔͇̹̦͖̠̙̭̮͎̽͑ͣ̀̌ͨͪ̄̕͡3͓̤̳͎̙̒̾̌̍̈̑͋̅̀ͦ́̀̚͢5̢̜̥̺͈̪̟͙̝̬͚̠͒͐̍̐ͪ͐̈́̋̃͢͟2̡͙̪̩̱̰̩͈̜̭͇̗͈̬̜͔̘̀̌̒ͣ͆ͭͪ͑ͦ̿́̕͢͝ͅ7̷͓̹͇͎͉̘̩̺͒ͮ̂̏ͯ̓̂̀̍̊ͭ̒̎5̷̵̮͓̤͍̮̦̯͖̈́͑͗ͭ̄͟͡͠8̡̫̻̖̲͓̮̱̱͇̙̳͕͎͛ͫ̾ͨ͌ͦ̃̍ͮ̓ͭͭ͗̓ͧ̆́͘6ͪ̈́̃̂̽͂̿̅̍̇̔͌҉̡̹͈̱̫̻̦̜̲̰̟̺̘̘̣̞̲͢2̡̫͚͎͙̫̯̠̼̳̘͉̝̙̭̟̊͒͛ͣ̌ͥͪ̏͑ͧͤ͛͢͞͞3̶̧̧̮̥̪͎̹͔̻̖̬̹͖̜͇̪̘͓͖͛͊̒͂̐͒̎̌̓ͥ͛ͥ̾̈͑͆ͫͪ̀1̸̼̳̮̘̙̥̙̲͙̪̪̝͈͔̠̭͗͗̊̒͂͌ͭ̀͜2̧̘̖͙̟̜̩̂̾͊̓̚͞7̵̡̦̲̤̱̫̳͕̤̾͌̎ͭ̅̆̓̾͆͑̀̀͡6̷̄ͤ̉͛̑ͥ̀ͩ̈ͧ̃͏̸̴̙͙͇̯̹͢4̒̀͗͐͊̃̍̈ͯ̈ͤ͊̊͑̅͂҉̤̥͔͕̤̳̠͔̠̩̰̼̜̖̪̭͘5̨͔̯̤̼͇̹̟͓̳̰̮͙̦̏̆̄̆͋̓͊̓ͥ͊̎ͬ͌ͩ͊7̵̡̛̼̝̻̥͇̬͂̏̌ͥ͗͒̀̑͡͠ͅ8̴͈̗̥̫͙̿ͫ̐̌̂́̐͘͞2̴̦͍̲̻͉̳̘̠̥̫͓̈̔̑͂͂̌͞6̈́̊ͮ̾̓̀͜͝͏̤̗̪̝̤̠͇̜͙͔̖̫͎̻̠̼͜͠4̶̑ͣ̋̅̀ͩͬ̒̓̓ͫͭͩ̓̅ͨ̽ͭ́͜͞͏̣̼̬̘̲͎̠̤̝1̷̡͍̜̳̦̙̬̱͍͈̪̺̪͉͎̦̌͑͒̅ͮ͒͊̃̒̕1̵̛̹̻̺͎͉̳̤͚̥̰̤͚̱̩̞̹͈͖̬ͪ̄̍̿̍̃9̵̖̭̪̱ͣͨ́̅̋ͮ̃ͫ̓͛͐ͩ̓ͫ̿͘͞͝ͅ8̷͎̪̙̖̽̍͗̐̂ͭ̃͟͟͞5̭͕͍̟̱̞͔̽͒̍̐̿ͫ͗ͦ̓ͫ̆̀͢1̴̡̍͂ͬ͌̊ͧͭ̓̑̾̅ͤ͗͠͝͏̦̟͚̲̦̜̭̟̰̝̺2͒̾̀̈́̏̉ͨ̅ͧ́͜͝҉̙̟̥̣͉̗͉3̍̑̆ͥ̓̌̊̈̃̄̋͋̾͗ͤ̓͊͘͏͖͍̗͔̱͍̦̱̭͉4̡͓̟̫̰͍̲̰͚ͧ̅̀́͐ͣͧ́͗̃ͤ͒ͯ̀̚̕͟5̛̟̼̮̘̤̟̻̪̰̤̺͍̩̪ͪ̍͐̂̀ͦ̿̂́̐̅̉̃̃̋̒̀̚͜͝͠ͅͅ7̵͙̼̗̞͎̺̣̈͋͛̒ͧ̄̏9̡̡̧͍͕̝̳̝͚̼͚̱̗̹̬̙̰͔͓̜ͬͦ̃̌ͣ̍̌̀̽͛͜8̧̡̥̱͕̘͔̥̭̬̦̬͚̲̰̲̘̜̞̮͙ͣ̾̽ͣ̾͋ͪ̐́͌̆ͩ̂͊̓̉̄̽͗͘͡͞4̢̼͎̠̹̠̤̺͓̼̼̩̠̾ͯ̈̌ͬ͒̽̃̊̋̉̊͛̃͌͆̂̆́͞3̺͓͚͍̹͙̖̖̝̱͉̲͗͒͐̅́͝1ͯ͊̽ͮ̇͛̓͜͏̧̘̭̙͈̮̘3̵̡͎͉͍̭̗̭̖̲̻̳͍̹̹̖̬̹̯͗͗͂ͪ̐̓͊2̶̌̄̈͛ͤ͡͝͏̵͉̦̙̜̩̗̠͇͉̬̫̣̰͍̗̪̖1̸̙̠̪̗ͯͧ́͊̓̌̏̈́͛͗̃̌͛̔͂͋͜͡ͅ6̵̨̖̯̖̠̣̮̹̹̩͖̼̥̺͉̰̙̼ͯ̓͛ͫ̓͂̓͑5̛̹̦̩̞ͨ̊̾ͩ͂͂̒7̢̺͔͇̹̦͖̠̙̭̮͎̽͑ͣ̀̌ͨͪ̄̕͡3͓̤̳͎̙̒̾̌̍̈̑͋̅̀ͦ́̀̚͢5̢̜̥̺͈̪̟͙̝̬͚̠͒͐̍̐ͪ͐̈́̋̃͢͟2̡͙̪̩̱̰̩͈̜̭͇̗͈̬̜͔̘̀̌̒ͣ͆ͭͪ͑ͦ̿́̕͢͝ͅ7̷͓̹͇͎͉̘̩̺͒ͮ̂̏ͯ̓̂̀̍̊ͭ̒̎5̷̵̮͓̤͍̮̦̯͖̈́͑͗ͭ̄͟͡͠8̡̫̻̖̲͓̮̱̱͇̙̳͕͎͛ͫ̾ͨ͌ͦ̃̍ͮ̓ͭͭ͗̓ͧ̆́͘6ͪ̈́̃̂̽͂̿̅̍̇̔͌҉̡̹͈̱̫̻̦̜̲̰̟̺̘̘̣̞̲͢2̡̫͚͎͙̫̯̠̼̳̘͉̝̙̭̟̊͒͛ͣ̌ͥͪ̏͑ͧͤ͛͢͞͞3̶̧̧̮̥̪͎̹͔̻̖̬̹͖̜͇̪̘͓͖͛͊̒͂̐͒̎̌̓ͥ͛ͥ̾̈͑͆ͫͪ̀1̸̼̳̮̘̙̥̙̲͙̪̪̝͈͔̠̭͗͗̊̒͂͌ͭ̀͜   orb. One post. Inactive.

87th. “Haha fooled you”  this is not the 87th world, nor are there problems here. […]  Rules:
87. post damp memes
87. don’t post problems
87.Haha fooled you
  too damp 4 u. Three posts. Inactive. 

88th. Banned.

89th. “Eighty-ninth World Problems”  The Eighty-ninth world exists only to those who do not. The problems of those inconvenienced by non-existence. Three posts. Inactive.

90th. Private.

91st. “∆”  .  ∆ Like the triangle world, except it’s all the same triangle. Four posts. Inactive.

92nd. “≈” . ≈. Like the previous world, but  ≈ instead of ∆. Two posts. Inactive.

93rd. “Crowleyverse”  Get your universe real-estate today. I’d like to purchase 20 shares of Crowleyverse stock. Header is… Aleister Crowley riding a cartoon bicycle? Two posts. Inactive.

94th. “ꙮ” ꙮ. ꙮ Ah, this again. Two posts. Inactive.

95th. “ ●●●CONGEAL●●●” ●●●The desert burns brightly, forever●●●  ●●●Where am I..?●●● Header is a surreal desert painting, featuring an hourglass and scissors. Many links to 9005th world. The content is strange remarks about the sun and wandering. Six posts. Inactive.

96th. “Where the Wildflowers Grow”  In wisdom, madness. In madness, wisdom. […]  Strive to speak not in straight lines, for this is a nest of wandering words and tangled webs.  I AM REBORN

Newly founded, and very reminiscent of the 45th world. Similar in the kind of poetic content and images it contains, but with a wildflowers and fire motif. Probably active.

97th. “97thworldproblems” There doesn’t seem to be anything here… One post. Inactive.

98th. “Zimmity Shoom A Skibbity Sham!” Shippity shoip a skipbitty bam! Shododpadroopadoopshoom! Everyone speaks in scat-singing language. Bright colors. Four posts. Inactive.

99th. “i got 99 problems” but a world ain’t one. . Created way earlier than the previous couple of subreddits, probably exclusively for the pun. Inactive.

hundred. “..//TRANSACTION_LOCKED–)//..”  LOAD–file://HTTP.TRANSM1SS1ON.C.NET%% world100th…..ERRORLOADING restart.  Fo0!?!ish mmm0rr74lsss Very green. Two posts. Inactive.

100th. “&”  जलाद्रक्षेत्तैलाद्रक्षेद्रक्षेच्छिथिलबन्धनात् | मूर्खहस्ते न मां दद्यादिति वदति पुस्तकम् ||   I have found the flower. Interesting. Some glitchy visuals, and varied content. Most of the posts turn out to be in Hindi or Nepalese script, if you run them through Google translate. Still active, but barely.

101th. The labyrinth ever expands. Private.

101st. “One-Hundred-First World Problems”.  yYyyYyYYYYYyYYyy YY ;:< YyyY <, yY YYYyy y♪yY♪Y♪YY♪ yyY♪ yyYyYYYyy   All weapons will be disappointed, I checked. Ys and music notes. Snow leopard print background. Inactive.

102nd. “102nd World Problems”  how u get heer true braev.  i am kill. My eyes, ow, thermo-vision cat header and deep pixel background. Two memespeak posts. Inactive.

103rd. “The unfortunate problems of the impoverished nations of the void”  A colony of the Star King.  Still raining, still dreaming. Three posts. Links to 200th world. Some Bork interactions. Inactive.

104th. “tUaReG” Wow, no posts. Inactive.

Oh god. There’s no 105th. (Dated: Dec 21 2015)

This is important: We’ve reached the end of the continuous chain. But don’t cry, there are plenty more.

106th. “One Hundred and Sixth World Problems” Welcome, to Änthüranm. These are/aren’t the rules you must/must not obey: One’s self should/shouldn’t refer to one’s self in the omniscient/unomniscient third being. Äanthüranm is/isn’t a utopia, so please do/don’t fight. {!}IMPORTANT NEWS | PLEASE READ/IGNORE{!} Header image is a Google deep-dream frog/forest thing. Has a cool contradiction-based grammar, but only one post. Inactive.

107th. “7 :UB: 6 :CRIBE:”  :H: :3L P: :M :E: Colons and numbers. Five posts. Inactive.

107. “UniVermultivergalaxy”  Sweet Mother, sweet Mother, send your child unto me, for the sins of the unworthy must be baptized in blood and fear.  Sanguinem suum colligitur. Creepy aesthetic: screaming face imprints and a pentagram. Red background. Links to /r/thEblacKRaBbit/. All is written in Latin. Four posts. Inactive.

108th. “Buddha Universe Problems”  Just because you’re enlightened doesn’t mean you don’t have things to complain about  Well, I THOUGHT I had this Nirvana thing down. 108 is a meaningful Buddhist number. Pretty self-explanatory. Nice header image. Four posts. Inactive.

109th is also missing.

110th. “011001010110010101100101011001″  01100101011001010110010101100101011001010110010101100101011001010110010101100101011001010110010101100101011001010110010101No posts! Inactive.

111th. “ 01010011011001010111011001100″  01010111011001010110110001100011011011110110110101100101001000000111010001101111001000000101100101101111011101010111001000 Oh okay. No posts. Inactive.

112nd. “Why the pain? Why must we the p’;ain” did you have toHEHE HE HEH HEHHHE EHEHHHEHHEHEHEHEHHHEEEE. No posts. Inactive. Worth noting that there’s no 112th.

113th. “˙̤⋮.⋱·̣.̈:⋱⋱˙̣:⋰.̈⋰.̣܈⋱:.̤:̈.·˙̤։:”  ∴∴∴˙̣܈⋱⋮∴∴⋯∴⋱⋱˙̣⋰⋯⋱  ⋱⋮∴∴⋱⋮∴∴˙̣˙̣˙̣⋰⋰˙̣˙̣˙̣˙̣⋰˙̣∴⋱⋱˙̣⋰⋯ Dots. Dots. Dots. I thought it was braille, but apparently not. Two posts. Inactive.

We now enter non-space, where worlds are few and far between.

127th. “Welcome to 127.0.0.0!”  ERROR: SERVER DOWNSERVER DOWNSERVER DOWN ERRORERRORERROR.  ping. Remember 43rd world? This is where they’ve relocated to. Server stacks. IT language. Nice blue theme. Semi-active, but dwindling.

130th. Private.

131st. Brought to you by the members of /r/Touhou. Private.

143rd. “FOR THOSE WHO ARE INFINITY”  I CAN SEE IT NOW I HAVE SEEN IT ALL I HAVE SEEN THE BEGINNING AND THE END, IT IS SO EXCRUCIATINGLY BEAUTIFUL.  I LOOK FORWARD AND I LOOK BACK. Two posts. Inactive.

151st. “151st World Problems”  From the time a Pikachu fried your bike to the time you ended up in a weird place after flying to Cinnabar Island… this is the place to talk about all your 151st world problems. No posts. Inactive. (151 because that’s the number of original pokemon.)

200th. “The Court of the Star King” 1) Pay Homage to the Star King. 2) Keep the Primordials sated and silent.  Analyzing substances. Some cross-worlds drama, also the Bork show up. Six posts. Seemingly inactive.

201st. “No” No  No Wow. All posts are the same, made by user Bolanok over the course of two years. Inactive. Inexplicably marked NSFW.

202nd. “202nd World Problems” This one has only existed for a month,  so perhaps someone has something planned for it. No posts and inactive as of yet.

216th. “The World of Forms”  On the Field of Πόλεμος  

From the wiki: Plato’s number is a number enigmatically referred to by Plato in his dialogue the Republic (8.546b).” … “ As for the number’s actual value, 216 is the most frequently proposed value for it, but 3,600 or 12,960,000 are also commonly considered.” Mostly content related to Platonic ideals, some interesting dialogues. Unfortunately only seven posts. Inactive.

222nd. “·°‡” No posts. Inactive.

225th. “Respond.” Respond.  Static. OP pls, the world. Three posts by user thebrrrzing, all claiming to be trapped and begging for a response. Inactive.

255th. “255th World Problems.” YOU MUST LISTEN TO THE SPIDERS. THEY ARE VERY GOOD SPIDERS. PERHAPS YOU WOULD LIKE TO MOVE HERE AND EXPERIENCE A BETTER TOMORROW.  Spider truth. Spider world for spiders. Four posts. Inactive.

256th. “8-bit world problems”  11001011 00001110 01100011 00100101 11010001 11111101 10111101 01011010 11010101 10110000 11000000 11100011 00100101 00000100 01000100 01011001 01001011 01001110 01100011 00100101 11010001 11111101 10111101 01011010 11010101 10110100 11011000 11100011 00100101 00000100 01000100 01011001  00110010 00110101 00110110 01110100 01101000 01110111 01101111 01110010 01101100 01100100 01110000 01110010 01101111 01100010 01101100 01100101 01101101 01110011 Another world with a binary gimmick. Four posts. Inactive.

273rd. “273rd world problems”  273rd world problems. No posts. Inactive.

276th. “The Blade of Umis”  The once proud world now rests as the latent energies of The Swordsman’s tool of destruction. Despite the implied backstory and worldbuilding, there are no posts. Hmm. Inactive, for now.

314th. “title”  31415. It’s Pi, get it? Three posts, inactive.

322nd. “Welcome Elites!”  |͇ Λ ͇||̶͇̿ ̶͇̿ ͇̿ |̶̿ ̶̿ ̶̿ ̶̿||̿ ̿ ̿\ |̶͇̿ ̶͇̿ ͇̿ ̿ ̿|̿ ̿ |̶ ̶ ̶ ̶| |̶͇̿ ̶͇̿ ͇̿ |̶͇̿ ̶͇̿ ͇̿ |͇ ͇ | ̿ ̿|̿ ̿ |̶͇̿ ̶͇̿ ͇̿   If you be on this subreddit, help it out. Make it the truth. Interesting header and background. Has an “elites of society worshipping satan” type theme going, with some pretty great conspiracy posturing. Seven posts. Inactive.

347th. “DEVOUR THEM”  NO DISRESPECTING THE GREAT DEVOURER KING. IF YOU DISRESPECT, YOU WILL BE DEVOURED.  This war can never end Claim to be at war with 1000th world and a couple of other subs. Maroon background, weak scary aesthetic. Inactive.

404th. Solving complex-world problems Googi step at a time. Private.

418th. “ ABRAHADABRA” ABRAHADABRA   ABRAHADABRA. Okay so the top post is spam, whatever. All the others are just the words “ABRAHADABRA”. That’s right, more thelemic stuff. Sacred geometry header. Four non-spam posts. Inactive.

420th. “Börk Weed Farms”  The Börk have discövered the pöwer öf the plant that is gröwn here. In exchange för security and aid, the ghetto here has allöwed us tö cöntröl the area and farm this weed.  mfw hit the blunt too hard. Our friends the Bork, and lots of 420 nonsense. A green background and exactly the header you’d expect. Six posts. Inactive.

446th. “My universe… not yours!”  Why 446? Why not?! It was a number I was randomly assigned… it’s just as good as any number.  ECHO!!. Mostly links to videos. Header is a crow-lion. Eight posts. Inactive.

475th. them problems tho. Private.

482nd. “No. Go away.” No posts. Inactive.

500th. “You’ve made it.”  Please avoid leaving. If you leave this subreddit, you will return to an alternate version of your own world. Nothing will ever be the same again. You will be fine. You have been warned. You are loved.  Please don’t stay here. Enjoy your R&R. Three posts. Inactive.

523rd. The labyrinth expands, can you outrun it? Private.

641st. “It’s a beautiful day. -641st World Problems”  If you came here looking for a sub in the vein of “Sixth World Problems” and it’s ilk, please, continue on. The name of our sub is only a consequence of all others being taken. […] Do not acknowledge the deviants. Some are bound to find their way here, but this place is not for them.  My house didn’t burn down today A strange world. Early posts describe genuinely pleasant events, whereas later ones riff on the “everything is nice” theme by expressing joy about terrible ones. Has an empty sister sub,  /r/641stWorldUplifting. Five posts. Inactive.

659th. Private.

666th. “Welcome To Hell.”  Can you fathom the Terror? It’s all in the title. Header is flames and a screaming woman. Red background. Just one post, though. Inactive.

666. “Six Hundred and Sixty Sixth World Problems”  Is hell to hot for you? Is that kid Jesus, from down the street, messing with your plans for corruption?  I keep setting all of these days for the apocalypse, but I always get stage fright when the day comes. Hell-world played straight. Ugh. One post. Inactive.

701st. “^701″ 1. Don’t. 2. {0} 3. 6. π. stop.universal   #d/7wi – 6:14a ° ydi {unsolved;} {post-calc;} Submissions are restricted. Two posts, displaying a peculiar grammar. Inactive.

747th. “Under control of the Colours”  The [STATUS:NEW] [OBJECT:TOWER] is [STATUS:COMPLETE].  Will the [REDACTED:COLOURS] [ACTION:INTERCEDE] in the [ABSTRACT:UNREST]? An outpost of the seventh world. The header is a second magnificent tower. Moderately active, although only posted to every couple of months.

777th. “LUCKY!!!!”  Problems in a world of good luck?! 'The hell’ you say!  If you got this far… you’re pretty lucky. Luckiest world. Slot machine header. Two posts. Inactive.

800th. “pppelleaes*(& heolp” the time((* is fall *& machine infinite and no (one) can sideways bend through transendence when are forced to chrono a noise into #th dimension when i pheel down on the worlds chiiiiii. No posts. Inactive.

801st. “A Higher Pantheon of Lesser Concepts”  What is the commonality between fools and.  Yearning. A series of short posts by user Dirk_the_Jerk. I cannot make head nor tail of them, but perhaps you can. Curiously lovely. Inactive.

844th. “It’s been [OMITTED] years”  What would happen if the cogs stopped working? I’d rather not find out.  Stolen Equipment. The maintenance team for some factory or boiler room, which the multiverse may or may not rely upon to function. Content is reports on the status of tools, facilities, other equipment. Machinery header. Active.

888th. “888th World Problems: Wel {exceeded/end} come to DUST{0000exceeded}BALL Solon” F A C I L I T I E S C U R R E N T L Y I N S H I F T […]  Arrivals are asked to report to Sectional Allocation - compartments will be assigned. Your welcome pack awaits. —SECTIONAL {0000exception} Tell // Shape _de-growth. Cuneiform in the header. Something between a facility, an archaelogical expedition, it’s not my job to figure this out, I’ve been awake for like 30 hours, guys. Peculiar grammar. Active.

973rd. “GREETINGS AND WELCOME CITIZENS OF PLANET EARTH” 973 973 EHT NAMUH 973 973 GREETINGS CITIZENS OF THE CITY OF NINE GATES.  RECEIVING TRANSMISSION. Based on this site. Gets a post every month or so. Black and red aesthetic.

976th. “…;…;.;..;;;;;……;..;..;….;..;..;.;.;.;.;.;.;;;;;;;;;.;.;;;..;..;..;.;.;;;..;.”  .;;;;;..;;;.;..;.;..;…..;.;;;;;;;…;.;…;..;.;.;..;;;;;;.;.;.;;;.;.;.;  ..;..;.;..;;.;;;;;;…;.;..;..;.;;..;;;;;;.;…..;.;..;..;…..;;;;; One post. All colons and semi-colons–I suspect this may be in morse or something, but I don’t have the heart to decode it. Inactive.

999th. “999thworldproblems” Speak purposefully, for the Runners are many and their time is running out. Beware Her gaze; her Ever-Watchful-Eye never sleeps. Never stop Running.  WATCHING. A creepy doll watches from the sidebar. Dedicated to unsettling images, mainly featuring eyes and dolls. Flagged as NSFW. Inactive.

1000th. “HAIL THE DEEP SPACE WASP KING”  PUNY CHILD FIRST WORLD! YOU AS YOU FOR WORLD TO WORLD FAILED AS SACRIFICE. THE CHILD FAILED FAILED THE CHALLENGE?[…]  YOU AS YOU EQUAL TO PARALYZED SPIDER PLACED INSIDE NEST TO FEED YOUNG.HIVE LAY EGGS IN YOUR HUSK BODY. HE ALONE, WHO OWNS THE YOUTH, GAINS THE FUTURE

The Hive, a race of superintelligent insects that pillage worlds, seeking to assimilate their inhabitants. Active.

1001ST. “…”  The End. A single post, detailing the total destruction of the cosmos post-assimilation by The Hive. Submissions restricted. Inactive.

1002nd. “hide” That’s it. No posts. Inactive.

1054th. “1054thworldproblems”  54th was the last well populated. There was an encouraging sign at the 81st, nothing in the 82nd, and a hotel in the 83rd. But that was so long ago. An empty world mourning emptiness. Inactive.

1066th. “High Kingdom of Dreiudd” Contribute frequently please. This is more of a guideline than a rule, but subscribers should claim a fiefdom and develop it, rather than claiming a fiefdom and not using it or not claiming a fiefdom at all.  A promotion. Users claim and rule fiefdoms, under the ultimate stewardship of their Queen. Active, with a couple of posts a month.

1074th. “The Great Wildlands”  For aeons these grounds were left untapped, and now it is unveiled by the most unlikely of voyagers. What they saw was truly something to behold. And you may find yourself agreeing, too. But beware, mother nature has grown a strong grasp on this land since it was last inhabited.  I cross the bridge into a forest much like those of Orbeluca. This place shall be known as Avon. The exploration of a new world. Wonders of nature, mythic constructions. Consult their wiki for more depth. Massive blue sky and plains in the header. Active.

1098th. “WELCOME TO THE BOWL” THE WALL is fully functional (<Welcome To The BOWL>) THE ARCHIVIST is NoW now now NOW actIVE.  GATLING BLADE in hand I RETURN to this place to find the VOICE I heard in the UPROAR. A world apart. Active. Indescribable, largely because of its dense connections to other worlds and subreddits. Header and background are abandoned Soviet monuments.

1101. “011000010111000001101111011000110110000101101100011110010111000001110011011001010000110100001010″  0101010001101000011001010010000001110111011011110111001001101100011001000010000001101.  010010000110010101101100011100000000110100001010 Oh, another binary world. SO ORIGINAL. One post. Inactive.

1234th. “1234″  4444  What the fuck? Two posts. Inactive.

1278th. “Dynamite - It’s Good For You!”  Welcome to our lovely little town! We are proud to be one of the first to be completely powered by an Atomic Power Plant! Wow! All of our houses are built out of lead to be extra sturdy and asbestos to keep warm while also being fireproof! As you can see, safety is our #1 concern!  I couldn’t imagine starting my day without these! American retro-futurism, with a taste for bombs. Dusty town as the header image, otherwise plenty of atomic safety label images.

1337th. “1337thworldproblems”  Y0 NIG44 1 4M 2 1337 4 U  50 1337. One post. Inactive. You get the joke.

1729th. “1729th World Problems”  Access the Akashic Database.  I saw myself today One post. Inactive.

1922nd. “Ojohn Apparelz and Armour” ooooooooo Ojohn oooooo clothes an armor for all ur Granfaffy needs. FISh watches so no stealss  of Openiingsz! This sure does exist. Headless bird header/background. Active. Nay, blossoming.

2000th. “2000th World Problems”  WHOA THESE DRUGS ARE OPENING ME UP TO THE WORLD MAN OH MAN LOOK AT MY HANDS THEY’RE GETTING BIGGER MAN OH WORLD DRUGS MAN OH MAN WHOA MAN WHOA DRUGS SHROOMS MAN OPEN UP TO WORLDS MAN LOOK AROUND YOU MAN MAN WHOA. Uh, no posts. Psychedelic cat background. Inactive.

2001st. “2001stWorldProblems”  They lie. There are four (4) multiverses. A, B, C, and D. STAY SAFE OUT THERE. No posts. Buddha header and… a water tower as the background? Inactive.

2634th. “2634th World Problems”  Cave-dwelling hors d'oeuvres vie against a race of flying napkins for much coveted marketing department employee-of-the-year plaques.  Leaflet Drop. Ummm. Wh-what they said? Two posts. Bruschetta header. Inactive.

2718th. “Respondemus In Aequatione.” Here is the home of number logic. Pure mathematics. All that can be is but an equation. You will find the answers you seek here. Go forth and indulge.  There is no law here Two posts. How did the spam bots find you? Inactive.

5030th. Private.

5245th. “5245th World Problems - Transantarctica” The House Tartus Di Inferi.  Arrival at Cache 1. Memos and correspondences between employees of a Transantarctican expedition. Sepia. Four posts, but possibly still active.

6037th. “Only A Matter Of Time” Territory of the bOuNdEdLaNDs. Used as a time mine.  TiMe iS BeInG EXtrAkTeD FrOm kLoKks AnD The PeOplE oF ThE BouNDedLaNdS ArE ThRiViNg! Where clocks are mined for time. Some inter-world drama. The Bork show up. Header is huge image of a creature with a clock for a face. Active.

7074th/ __ )___ __ ______ ____ _/ / / _ / _ / / / / __ / __ / / // / / // / // / / / // /
//\/_, /\// /_/\,/
/___/
. Private.

8000th. Bradley Dobbleson. Private.

8453th. Welcome to 8453th World Problems, for thing you find annoying in The Republic Of Hot Dogs. No posts. Inactive.

8901st. “PRIMARY”  ᴤөөʞ ʇµө ⊂ODEX […]  BEYOND LIES OLD ANTIGONE TO THE NORTH AND THE FOETID GARDEN TO THE SOUTH. BEYOND THE PROMONTORY OF YANN, SPANNING EAST TO WEST, SLEEP THE OLD CITIES OF INDUSTRY AND KNOWLEDGE.  TWIN SUNS

I don’t know, but it looks cool. Some wonderful paragraphs of mythmaking that my brain is too sleep-addled to parse. Background is plains. Slow, but probably still active.

9001st. “For World Problems Greater than 9000″  This exists bacause. So here we are. Two posts. Inactive.

9005th. “Share” Become one with your Brother. Share his thoughts, he’ll share your body.  Dream. Pre-industrial meditations. Forest and tents as the header. Inactive.

9999th. “9999th World Problems”  I can not stop entropy. Egyptian wall painting header, bright yellow and orange backgrounds. This theme is not reflected in the content. Three posts. Inactive.

10032nd. “[[[]]][][]][][[][]][]]][][]][]][[][]][]][[][[][]][][][[]][]][][[][][]][][]][][][]][]][]]]]]]]]]]”  [[[[[[[[[[]]]]]]]]]]]]  ][[][[][]]]. Top post is spam, so I ignored it. Three posts. Inactive. Square brackets.

12345th. “Your new home.”  Fish: YAY I’VE BEEN CAUGHT  12345 Two posts, one of which is spam. Inactive.

17284th. “17284th World Problems”  Ooooooohhh Supermarche  Its WAR!!! Fucking wonderful. War-mongering supermarket. Supermarkets. Yes. Active.

29979th. “So I decided to simulate a Universe”  We are scientists. We decided to construct a singularity and simulate a universe. Why? Because we can. That’s the only reason we need.  Can I help with your project to simulate a universe? Purple and blue space clouds. Notes on the progress of the simulated universe, appearance of matter, life, etc. Active.

67698th. “67698th World Problems: Brutalists and Rice”  Brutalism + Forgiveness = The Hive Machine. - No meaning  Occupation 1. Links to images of brutalist architecture, and rambling, bleak slice of life prose. A human zoo. Slow, but active, with a few posts a month. Grey.

80085th. “80085thworldproblems” Uh, okay. Nothing. Inactive.

90000th. “I AM THE ALPHABET” LOVE IS FEAR FEAR IS PAIN PAIN IS LOVE. Empty. God. Inactive.

90210. “AWARDTH!”  Thank You All Very Much. As I write this, on December 25, 2015, 2:26 AM, this subreddit was founded approximately a day ago. They can’t be stopped. The worlds multiply. Please kill me.

90218th. “90218th World Problems”  At G.O.M.M Industries and Subsidiaries Inc. we work hard to bring you a wide range of products, most of which have been deemed safe for consumption by your local authority thanks to carefully placed bribes the diligence and efforts of our skilled slaves employees.  Aren’t you EXCITED!? A  G.O.M.M Industries and Subsidiaries Inc. world. Owned by Faffy Trump. Header is moneys. Background is cubicles. Seven posts. Inactive.

94231st. “94231st World Problems” 12 drink miminum. Why not feed that gargantuan subterranean grub body with wings! And a salty beverage whyle your attic? You came to the right plaice.  Hoi Hoi! Some kind of pub? Shitposty fifth world creepiness X cooking channel, idfk. Garish. Inactive.

99998th. “🆗😄👬💬💝📷😂❎🌚❤☀😍”  🎏👬💬🆗🏠👮➡4⃣    🆗. One post. Inactive. Ahahaha

99999th. “what lies within the the when you WHEN YOU SEE”  oh once i walked and left ledt a ha ha ha ha ha lonely place i and i held her hand her hand i woke up and saw eyes ever ywhere.  look how they send you into insanity. A troubled world, surely beyond the grasp of the fragile human mind. Let’s not tarry here. Fuck. Five posts. Inactive.

100000th. “100000thworldproblems”  Aaa aaaA aaaa aAaaaA aaAa. AaaaA! Aa? All flagged NSFW, for no reason. Two posts. Inactive.

111111st. “The Front Page Of The Internet” WELCOME TO RIDDERITT!!! THE FRONT PAGE OF THE INTERNET! HAVE FUN! PLEASE FOLLOW THE RULES!  111111. Parody of Reddit culture, but like, more melancholy than the usual circlejerk. Background is a melting desktop. Active.

200000th. “ALAK ALAK ALAK ALAK ALAKALAK ALAK ALAK ALAK ALAKALAK ALAK ALAK ALAK ALAKALAK ALAK ALAK ALAK ALAK”  ALAK ALAK ALAK ALAK  ALAK ALAK ALAK. Okay. One post. Inactive.

563233. “yes”  meow renchto lenieort? Likes purple. One post. Inactive.

666666th. “666666TH WORLD PROBLEMS”  hecomes .heyou devour 8*881u35noj—- efwnokhelp us…. weonf please.  HE WILL DEVOUr us alll- 90uy ftwcbn8/i5 7778 Four posts. Inactive. I hate humans.

672514th. “672514th World Problems”  (4)21[(6)]43 | Two posts. Inactive.

959270th. “FLUGUFRELSARINN” IMAREASONABLEMANGETOFFMYCASEIMAREASONABLEMANGETOFFM. Why does this exist. No posts. Inactive.

999998th. “???? ??? ????????? ???????? ???” ??????????????????? ????? ???????????? ?????????????????????????????????????????? ?????????????????? ???????? ??????????? ????????????????????????????????????????. Just. Fucking. Question marks. You sick fucks. One post. Inactive.

999999th. “1000000thworldproblems” E͖̘͈̻l̴̟͉͕͎̪͓e̹ga͔n̺̥̬͙t̻͎̤ ̜̭͎̪͓͚ŕ̯̲̝̩̜̱͚u͕̱͖̖̣͜l̢e͓s͈̼̳̪̪̥̲ ̬̙̰̖ị̥̺͇͈͓n ̶̼̟͙̬f̥̱͘r̵͔̣̦̺͎o͓͔̻̗̲̖͜n̛͙̣̳̲͈͉ͅt̮̞̜̖̭͕̦̕ ̠́o̳̲̯̫͡f͍͕̮̜͍̜̪ ̵͔͎y͈̠͈̤̩͈̭o̠u̱̮͓͉̟̣,͜ ̹͎͟ev̝en̮̭͖̠̠̳ t̟͕̪̺̦̬̥h̷͚̗os͕̼̜̹̲̣̀e̗͕͖͙̺͈͇ ̷̣̯͈̯̥͇͇w̝̤̪̪h̶o̠ ͈̰r̝̬͖u̶l҉̥e̯̬ ̰̜͈̠̙͟w̧̰͇̞̞͍̜̭i̟͉̤̕ͅt͓̼̼̜͖̱͝h̨̰̹̦ͅ ̣͉̦͡a͚̖̤ ̹͕̯͎͓r̮͘o̫̻̻̻̜͡m̕a͓̥̙̖̬̙͖n̫̗͔̭͟ț̵̘͎̟i̫̟͙͍͕̟c ͕̜m̪̘͓͎ąn͍̰̫͍̤͖͇ ḽ̲̯̠͍̙̳̠o̸͏̳͎̣̬ǫ̛̟͇͙̹͕͇͓k͙̠͓ͅe̶͙̘͚͓̦͕̤d̥̱͉͘ ̙̺͓̭͈̖͕̻b͢͏͓͖̘̖̹͡ą̧̤̪̦̦͍͚ç̭͙͕k̨̯̜̣͔̩̠ ̶̹͖̺̗̩̱͖̰͉͢a̷̱̟̫͎̹͙͕̳͘͡t̨̙̻̹͍͉͉͙͜ ̣̰̪̳͙̻̮̬̙t͓̩͙͇̲̪̼͝ͅh̛͍̬̭͇̺͢e̢̖̞͍̘̙ ̦̺̳͓̜͚́͜͠s̼͇͚̼̦c̵̡̟̠͕̜̺̮̞̣h̦̮̟̣̖o̡̙̜o҉͎͢l̸̥̝̭̣̝͚͈̜͜ś̠̜̱̣͇̣͈ͅ ̜̩̀o̷̬̖̠̟̘̟f̷̘͙͍̥̞͠ ̧͓͙̫͈̘̳̺̠t̸̠̻̼̱̟͔h̜͙̹͕̣̞̘͟ḛ̭ ̧̙̻̝N͕̺̬͈͘e̯̺̱͕̻̞t҉̪h̵̶̳̮̘̗̻e̹̫̪͙͇̱ͅr͎̘̣̦̙̣̝̫l͜҉̘̙a̸̻̼n̶̢͏̭̠̖̱͚͓̯̲͕d̛͕̗̣̹͡s̷̮ͅ:̛̞̮̙̺̰ )(*&)(*^^&*. Two posts. Inactive.

67803421. “67803421 World Problems” NICK SABAN IS THE LIFE AND THE LOVE. HE WHO MUST ONLY BE ADRESSED BY “BASED SENPAI OGRE-LORD SABAN”. FOOTBALL SEASON IS NEARYING. SO IS BASED SENPAI OGRE_LORD SABANS REIGN OF TERROR ON THE SEC. I… I just don’t know. Two posts. Inactive.

3H91rd. “█████▄▄▀▄██▀”  ⅍◊ █▄▄▀███████ 
▀█▄█▄▀█ . Ugh. What the fuck. That’s not even a real number. Two posts. Static. Static everywhere. Inactive.

So, is this it? Is this where it all ends?

Of course not. There are still several directions to abstract into:

Take, for example, the five + subreddits dedicated to forms of the zero-eth world.

An inordinate number of googleplexes. Many infinities.

The negatives. Fractions. i and pi. Sets? God fucking stop already.

I’m so weary.